Detail of EST/Unigene AB098730 |
Acc. | AB098730 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase homolog NTF4 OS=Nicotiana tabacum E-value=0; Mitogen-activated protein kinase homolog D5 OS=Pisum sativum E-value=0; Mitogen-activated protein kinase homolog MMK1 OS=Medicago sativa E-value=0; Mitogen-activated protein kinase 1 OS=Oryza sativa subsp. japonica E-value=0; Mitogen-activated protein kinase 6 OS=Arabidopsis thaliana E-value=0; |
Length | 1206 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_CDS; |
Sequence | ATGGATGGTTCTGGTCAGCAGTCGGACACGATGATGTCTGATGCGGGGGCGGAGCAGCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04371 extracellular signal-regulated kinase 1/2 |
EC | 2.7.11.24 |
Transcription Factor Family | WRKY |
Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
Probeset |
|
Corresponding NCBI Gene | 818982 |
Trichome-related Gene from Literature | 818982 |