| Detail of EST/Unigene AI484859 |
| Acc. | AI484859 |
| Internal Acc. | EST243120 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 1-aminocyclopropane-1-carboxylate synthase OS=Glycine max E-value=3e-83; 1-aminocyclopropane-1-carboxylate synthase 2 OS=Solanum lycopersicum E-value=5e-82; 1-aminocyclopropane-1-carboxylate synthase OS=Nicotiana tabacum E-value=4e-81; 1-aminocyclopropane-1-carboxylate synthase 6 OS=Arabidopsis thaliana E-value=2e-80; 1-aminocyclopropane-1-carboxylate synthase 1 OS=Prunus mume E-value=4e-80; |
| Length | 575 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_TAMU; |
| Sequence | TTCATCCAACACAAAATCCTAATGGTGTTATTCAAATGGGTTTGGCTGAAAATCAGCTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00814 alanine transaminase |
| EC | 2.6.1.2 4.4.1.14 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826730 |
| Trichome-related Gene from Literature | 826730 |