Detail of EST/Unigene AI488630
Acc. AI488630
Internal Acc. EST246969
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 40S ribosomal protein S13-2 OS=Arabidopsis thaliana E-value=3e-11; 40S ribosomal protein S13-1 OS=Arabidopsis thaliana E-value=3e-11; 40S ribosomal protein S13 OS=Glycine max E-value=8e-11; 40S ribosomal protein S13 OS=Zea mays E-value=4e-10; 40S ribosomal protein S13-2 OS=Oryza sativa subsp. japonica E-value=4e-10;
Length 99 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_TAMU;
Sequence GGCACATGGGCTTGCACCTGAGATTCCAGAGGATTTGTACCACCTGATTAAGAAAGCTGT
TGCCATTAGGAAGCATTTGGAGAGGAACAGGAACGATAA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology Genetic Information Processing > Translation > ko03010 Ribosome > K02953 small subunit ribosomal protein S13e
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 828167 
Trichome-related Gene from Literature 828167