| Detail of EST/Unigene AI488984 |
| Acc. | AI488984 |
| Internal Acc. | EST247323 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Delta(24)-sterol reductase OS=Arabidopsis thaliana E-value=2e-13; Delta(24)-sterol reductase OS=Pisum sativum E-value=1e-11; Diminuto-like protein OS=Caenorhabditis elegans E-value=4e-06; |
| Length | 100 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_TAMU; |
| Sequence | TAGGGACTACTACCACAGACACATTAGATCGTTGTATTGGGAAGGTAAACTAATTCTTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.3.1.- 1.3.1.72 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821519 |
| Trichome-related Gene from Literature | 821519 |