| Detail of EST/Unigene AI489600 |
| Acc. | AI489600 |
| Internal Acc. | EST247939 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=5e-37; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=6e-35; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=1e-34; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=9e-28; 30S ribosomal protein S14 OS=Maricaulis maris (strain MCS10) E-value=6e-20; |
| Length | 357 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_TAMU; |
| Sequence | CTTTGGGGAAGAAATTCACGAGAAATATTCAAGATAACAAACGCAGATTGTTGTCTGCTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818015 |
| Trichome-related Gene from Literature | 818015 |