Detail of EST/Unigene AI772162 |
Acc. | AI772162 |
Internal Acc. | EST253262 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71A1 OS=Persea americana E-value=3e-39; 2-methylbutanal oxime monooxygenase OS=Manihot esculenta E-value=5e-33; 2-hydroxyisoflavanone synthase OS=Glycine max E-value=1e-32; Cytochrome P450 93A1 OS=Glycine max E-value=6e-31; Cytochrome P450 71A9 OS=Glycine max E-value=1e-30; |
Length | 528 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_RES; |
Sequence | GAAGAATTTCACACAATTTTACAAATATGTACTTGACGATCACAACGCAATAAAGATGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00513 cytochrome P450, family 21, subfamily A (steroid 21-monooxygenase); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
EC | 1.14.99.10 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 3769237 |
Trichome-related Gene from Literature | N/A |