| Detail of EST/Unigene AI774099 |
| Acc. | AI774099 |
| Internal Acc. | EST255199 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase OS=Hyoscyamus muticus E-value=3e-61; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=3e-46; Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=3e-45; Glutathione S-transferase F2 OS=Arabidopsis thaliana E-value=4e-39; Glutathione S-transferase F3 OS=Arabidopsis thaliana E-value=9e-39; |
| Length | 394 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_RES; |
| Sequence | GGAACTTGTTCCTGTTAATATGCAAGCTGGTGATCACAAAAAGGAACCATTCATTTCTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 1.11.1.9 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827931 |
| Trichome-related Gene from Literature | 827931 |