| Detail of EST/Unigene AI774324 |
| Acc. | AI774324 |
| Internal Acc. | EST255340 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=6e-11; Chlorophyll a-b binding protein 22R, chloroplastic OS=Petunia sp. E-value=2e-08; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=2e-08; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=5e-08; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=8e-08; |
| Length | 103 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_RES; |
| Sequence | GGCTGTTGCCAAGTCCGCCCCATCTAGCAGACCATGGTATGGCCCTGACCGTGTCAAGCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |