| Detail of EST/Unigene AI774829 |
| Acc. | AI774829 |
| Internal Acc. | EST255929 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Solanum pennellii E-value=2e-11; Ribulose bisphosphate carboxylase/oxygenase activase 2, chloroplastic OS=Nicotiana tabacum E-value=1e-10; Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplastic OS=Nicotiana tabacum E-value=1e-09; |
| Length | 137 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_RES; |
| Sequence | CATCAATTTCTTTTTAGTCATCAAGAATGGCTGCCTCAGTGTCAACCATTGGAGCTGCCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |