Detail of EST/Unigene AI775280 |
Acc. | AI775280 |
Internal Acc. | EST256380 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-82; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=5e-82; Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=9e-82; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=1e-81; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=1e-81; |
Length | 527 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_RES; |
Sequence | TTTTGGCCCGTAATGGTGTTAAGTTCGGTGAAGCTGTATGGTTCAAGGCTGGATCACAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |