Detail of EST/Unigene AI777296 |
Acc. | AI777296 |
Internal Acc. | EST258261 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; |
Length | 726 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_RES; |
Sequence | GGTGCTGGACAGGCAGTCAAACTCTCACCATCTGCCTCAGAAAATTCTGGAAATGGAAGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |