| Detail of EST/Unigene AI777836 |
| Acc. | AI777836 |
| Internal Acc. | EST258715 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Sulfite reductase 1 [ferredoxin], chloroplastic OS=Nicotiana tabacum E-value=5e-72; Sulfite reductase [ferredoxin], chloroplastic OS=Pisum sativum E-value=6e-60; Sulfite reductase [ferredoxin], chloroplastic OS=Arabidopsis thaliana E-value=2e-41; Sulfite reductase [ferredoxin], chloroplastic OS=Zea mays E-value=1e-37; Sulfite reductase [ferredoxin] OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=8e-28; |
| Length | 596 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_SUS_LEAF; |
| Sequence | TATAAGGGTAACAGGTTGTCCCAATGGATGTGCTCGACCATACATGGCTGAACTTGGATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830336 |
| Trichome-related Gene from Literature | 830336 |