| Detail of EST/Unigene AI778114 |
| Acc. | AI778114 |
| Internal Acc. | EST258993 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ras-related protein rac-2 OS=Caenorhabditis elegans E-value=1e-31; Rac-like GTP-binding protein ARAC6 OS=Arabidopsis thaliana E-value=9e-31; Rac-like GTP-binding protein RHO1 OS=Beta vulgaris E-value=9e-31; Rac-like GTP-binding protein ARAC1 OS=Arabidopsis thaliana E-value=9e-31; Rho-related protein racE OS=Dictyostelium discoideum E-value=1e-30; |
| Length | 423 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_SUS_LEAF; |
| Sequence | CAACAATCAGGTCTTCTGCAGAAGATCTGAGAGAGAGGGATACCTACCAAAATGAGCGCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829750 |
| Trichome-related Gene from Literature | N/A |