| Detail of EST/Unigene AI779108 |
| Acc. | AI779108 |
| Internal Acc. | EST259987 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-15; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-15; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-15; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=3e-15; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=3e-15; |
| Length | 109 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_SUS_LEAF; |
| Sequence | CCCATGGTATGGGGCTGACCGTGTTAAGTACTTGAGCCCATTCTCTGGTGAATCACCAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |