Detail of EST/Unigene AI780170 |
Acc. | AI780170 |
Internal Acc. | EST261049 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Solanum tuberosum E-value=9e-74; Cysteine synthase OS=Citrullus lanatus E-value=2e-69; Cysteine synthase OS=Spinacia oleracea E-value=7e-69; Cysteine synthase OS=Triticum aestivum E-value=4e-68; Cysteine synthase OS=Zea mays E-value=6e-68; |
Length | 473 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_SUS_LEAF; |
Sequence | ATGTAACTNAATTGATATGTAACACTCCTTTGGTATACCTGAATAATGTTGTGGATGGGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
EC | 2.5.1.47 4.2.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827145 |
Trichome-related Gene from Literature | 827145 |