Detail of EST/Unigene AI780226 |
Acc. | AI780226 |
Internal Acc. | EST261105 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=5e-16; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=5e-16; Chlorophyll a-b binding protein 1A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=1e-14; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=4e-13; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=9e-13; |
Length | 187 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_SUS_LEAF; |
Sequence | CAACAATATCTCATACCATCAAACACTTACATTTCTCTTGATATAAACACCATGGCAGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |