| Detail of EST/Unigene AI780766 |
| Acc. | AI780766 |
| Internal Acc. | EST261645 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=1e-12; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=7e-12; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=3e-10; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=3e-09; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=3e-09; |
| Length | 148 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_SUS_LEAF; |
| Sequence | GGCTCTTTCTTCCCCTTCTTTTGCTGGACAAGCAGTGAAACTCTCACCATCTGCCTCAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818006 |
| Trichome-related Gene from Literature | N/A |