Detail of EST/Unigene AI780787
Acc. AI780787
Internal Acc. EST261666
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=1e-12; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=1e-12; Chlorophyll a-b binding protein 1A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=3e-11; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=4e-11; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=1e-10;
Length 115 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_SUS_LEAF;
Sequence CCATGGCAGCTGCTACAATGGCTCTTTCTTCTCCTTCTTTTGCCGGACAGGCAGTGAAAC
TCTCACCCTCTGCCTCAGAAATCTCTGGAAATGGAAGGATCACCATGAGAAAGGC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 839871 
Trichome-related Gene from Literature 839871