Detail of EST/Unigene AI898851 |
Acc. | AI898851 |
Internal Acc. | EST268294 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=1e-36; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=2e-34; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=4e-34; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=3e-27; 30S ribosomal protein S14 OS=Maricaulis maris (strain MCS10) E-value=2e-20; |
Length | 423 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_TAMU; |
Sequence | CAGCTTTGGGGAAGAAATTCACGAGAAATATTCAAGATAACAAACGCAGATTGTTGTCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818015 |
Trichome-related Gene from Literature | 818015 |