| Detail of EST/Unigene AJ249245 |
| Acc. | AJ249245 |
| Internal Acc. | |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Allene oxide synthase, chloroplastic OS=Linum usitatissimum E-value=6e-98; Allene oxide synthase, chloroplastic OS=Arabidopsis thaliana E-value=7e-96; Allene oxide synthase OS=Parthenium argentatum E-value=5e-88; Allene oxide synthase 2 OS=Oryza sativa subsp. japonica E-value=7e-85; 9-divinyl ether synthase OS=Nicotiana tabacum E-value=6e-81; |
| Length | 1479 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_CDS; |
| Sequence | GGCACGAGACCGAACTCTCTTCTCTTCTTCTCTACCATGTCACTCCCACCACCGATACCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | ; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07424 cytochrome P450, family 3, subfamily A |
| EC | 1.14.-.- 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827215 |
| Trichome-related Gene from Literature | N/A |