| Detail of EST/Unigene AJ293274 |
| Acc. | AJ293274 |
| Internal Acc. | |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase kinase 4 OS=Arabidopsis thaliana E-value=0; Mitogen-activated protein kinase kinase 5 OS=Arabidopsis thaliana E-value=0; Mitogen-activated protein kinase kinase 1 OS=Oryza sativa subsp. japonica E-value=1e-54; Mitogen-activated protein kinase kinase 2 OS=Arabidopsis thaliana E-value=3e-51; Mitogen-activated protein kinase kinase 6 OS=Arabidopsis thaliana E-value=2e-50; |
| Length | 1536 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_CDS (1 ESTs); |
| Sequence | GGAACCTTCTCTTCTTCTATTCACTACTCACATCACCATGCTTTCTTTTCTTCATTCATA |
| EST members of Unigene | AJ293274 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04369 mitogen-activated protein kinase kinase 2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04369 mitogen-activated protein kinase kinase 2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04369 mitogen-activated protein kinase kinase 2 |
| EC | 2.7.12.2 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
| Probeset |
Msa.1719.1.S1_at
|
| Corresponding NCBI Gene | 841591 |
| Trichome-related Gene from Literature | N/A |