| Detail of EST/Unigene AJ416757 |
| Acc. | AJ416757 |
| Internal Acc. | |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alpha-(1,4)-fucosyltransferase OS=Arabidopsis thaliana E-value=0; Alpha-(1,3)-fucosyltransferase 10 OS=Xenopus laevis E-value=3e-16; Alpha-(1,3)-fucosyltransferase 10 OS=Xenopus tropicalis E-value=4e-16; Alpha-(1,3)-fucosyltransferase C OS=Drosophila melanogaster E-value=2e-15; Alpha-(1,3)-fucosyltransferase 10 OS=Bos taurus E-value=4e-15; |
| Length | 807 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_CDS; |
| Sequence | TATTTGTATTCTTGATCGTTGTGGGTTGAGTTGTTTGTGGACTAAATCCAATGTTCTTGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.4.1.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843530 |
| Trichome-related Gene from Literature | N/A |