Detail of EST/Unigene AJ416757 |
Acc. | AJ416757 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alpha-(1,4)-fucosyltransferase OS=Arabidopsis thaliana E-value=0; Alpha-(1,3)-fucosyltransferase 10 OS=Xenopus laevis E-value=3e-16; Alpha-(1,3)-fucosyltransferase 10 OS=Xenopus tropicalis E-value=4e-16; Alpha-(1,3)-fucosyltransferase C OS=Drosophila melanogaster E-value=2e-15; Alpha-(1,3)-fucosyltransferase 10 OS=Bos taurus E-value=4e-15; |
Length | 807 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | TATTTGTATTCTTGATCGTTGTGGGTTGAGTTGTTTGTGGACTAAATCCAATGTTCTTGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.4.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843530 |
Trichome-related Gene from Literature | N/A |