Detail of EST/Unigene AJ496895 |
Acc. | AJ496895 |
Internal Acc. | AJ496895 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoribulokinase, chloroplastic OS=Triticum aestivum E-value=2e-53; Phosphoribulokinase, chloroplastic OS=Mesembryanthemum crystallinum E-value=1e-52; Phosphoribulokinase, chloroplastic OS=Spinacia oleracea E-value=9e-52; Phosphoribulokinase, chloroplastic OS=Arabidopsis thaliana E-value=4e-49; Phosphoribulokinase, chloroplastic OS=Chlamydomonas reinhardtii E-value=3e-43; |
Length | 567 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTFLOW; |
Sequence | TGATGATGGTTCTACATTTCATGGATACCATGTGGAAGGAAACTTACATGCTCTTATCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840098 |
Trichome-related Gene from Literature | N/A |