Detail of EST/Unigene AJ497003 |
Acc. | AJ497003 |
Internal Acc. | AJ497003 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 6A, chloroplastic OS=Solanum lycopersicum E-value=4e-11; Chlorophyll a-b binding protein 6, chloroplastic OS=Arabidopsis thaliana E-value=4e-11; Chlorophyll a-b binding protein 1B-21, chloroplastic OS=Hordeum vulgare Ib-21 E-value=2e-10; Chlorophyll a-b binding protein of LHCII type 1 (Fragment) OS=Euglena gracilis E-value=3e-07; Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. E-value=5e-07; |
Length | 203 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTFLOW; |
Sequence | CATGGGGCACCCTACCACCATTTGGTCATTGAGTTCCTTTCTATGCTTTTGTTGAGCACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824654 |
Trichome-related Gene from Literature | N/A |