Detail of EST/Unigene AJ497034 |
Acc. | AJ497034 |
Internal Acc. | AJ497034 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Pentatricopeptide repeat-containing protein At1g80270, mitochondrial OS=Arabidopsis thaliana E-value=5e-14; Pentatricopeptide repeat-containing protein At1g15480, mitochondrial OS=Arabidopsis thaliana E-value=3e-12; Pentatricopeptide repeat-containing protein At3g15590, mitochondrial OS=Arabidopsis thaliana E-value=5e-10; |
Length | 193 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTFLOW; |
Sequence | AGAATGAAACAGGCTGTTATATATCTCGACTAAAGCAGTACCAAATTCTTATAGAGGCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844367 |
Trichome-related Gene from Literature | N/A |