Detail of EST/Unigene AJ497072 |
Acc. | AJ497072 |
Internal Acc. | AJ497072 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Pyruvate kinase, cytosolic isozyme OS=Nicotiana tabacum E-value=4e-23; Probable pyruvate kinase, cytosolic isozyme OS=Arabidopsis thaliana E-value=4e-18; Pyruvate kinase, cytosolic isozyme OS=Glycine max E-value=1e-16; Pyruvate kinase, cytosolic isozyme OS=Solanum tuberosum E-value=3e-16; |
Length | 213 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTFLOW; |
Sequence | GGATCTTTCTGTTGTTGTCCTGAGCTAACGACTGATACCTTTGATTGGTCATGCAGTGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835735 |
Trichome-related Gene from Literature | N/A |