| Detail of EST/Unigene AJ497126 |
| Acc. | AJ497126 |
| Internal Acc. | AJ497126 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=6e-31; Glucan endo-1,3-beta-glucosidase GII OS=Hordeum vulgare E-value=3e-27; Glucan endo-1,3-beta-glucosidase, acidic isoform OS=Zea mays E-value=1e-26; Glucan endo-1,3-beta-glucosidase GI OS=Hordeum vulgare E-value=9e-26; Glucan endo-1,3-beta-glucosidase GV OS=Hordeum vulgare E-value=1e-25; |
| Length | 442 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTFLOW; |
| Sequence | CGGGATCTTTTTGATGCCCAGTTAGATTCAGTATACGCGCTCTTGAGAAAGTTGGCGCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824891 |
| Trichome-related Gene from Literature | N/A |