| Detail of EST/Unigene AJ497417 |
| Acc. | AJ497417 |
| Internal Acc. | AJ497417 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glycine cleavage system H protein, mitochondrial OS=Oryza sativa subsp. japonica E-value=2e-12; Glycine cleavage system H protein, mitochondrial OS=Oryza sativa subsp. indica E-value=2e-12; Glycine cleavage system H protein OS=Vibrio vulnificus (strain YJ016) E-value=5e-12; Glycine cleavage system H protein OS=Vibrio vulnificus (strain CMCP6) E-value=5e-12; Glycine cleavage system H protein, mitochondrial (Fragment) OS=Flaveria pubescens E-value=5e-12; |
| Length | 141 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTFLOW; |
| Sequence | TGACATCAACTCTCCTGTTTCAGGAAAAGTGATTGAAGTTAATGAAGAGCTCAGCAACTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818078 |
| Trichome-related Gene from Literature | N/A |