Detail of EST/Unigene AJ497453 |
Acc. | AJ497453 |
Internal Acc. | AJ497453 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=6e-32; Glucan endo-1,3-beta-glucosidase, acidic isoform OS=Zea mays E-value=3e-30; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=3e-28; Glucan endo-1,3-beta-glucosidase GI OS=Hordeum vulgare E-value=3e-28; Glucan endo-1,3-beta-glucosidase GII OS=Hordeum vulgare E-value=2e-27; |
Length | 352 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTFLOW; |
Sequence | GCTTCCGGTGTGAAGATAGTTGTGTCCGAGAGTGGGTGGCCATCTGCAGGTGGAGATAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824891 |
Trichome-related Gene from Literature | N/A |