Detail of EST/Unigene AJ497475 |
Acc. | AJ497475 |
Internal Acc. | AJ497475 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cinnamate beta-D-glucosyltransferase OS=Fragaria ananassa E-value=6e-54; Putative UDP-glucose glucosyltransferase OS=Fragaria ananassa E-value=3e-52; Limonoid UDP-glucosyltransferase OS=Citrus unshiu E-value=3e-51; UDP-glycosyltransferase 84A1 OS=Arabidopsis thaliana E-value=3e-45; UDP-glycosyltransferase 84A2 OS=Arabidopsis thaliana E-value=5e-44; |
Length | 604 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTFLOW; |
Sequence | GGATGAAGAACTTACATTGATGTCACTCAACTCTTCTATAGTTCTTAAATACAACGAAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
EC | 2.4.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827220 |
Trichome-related Gene from Literature | 827220 |