Detail of EST/Unigene AJ497490 |
Acc. | AJ497490 |
Internal Acc. | AJ497490 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase OS=Vitis vinifera E-value=6e-52; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=7e-49; Naringenin,2-oxoglutarate 3-dioxygenase OS=Dianthus caryophyllus E-value=5e-47; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Matthiola incana E-value=2e-46; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=3e-46; |
Length | 445 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTFLOW; |
Sequence | TCACCAGTTGAAGGTGCTTTTGTTGTTAATCTTGGAGACCATGGTCATTATCTAAGTAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824287 |
Trichome-related Gene from Literature | 824287 |