| Detail of EST/Unigene AJ497695 |
| Acc. | AJ497695 |
| Internal Acc. | AJ497695 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Primary amine oxidase OS=Pisum sativum E-value=5e-67; Primary amine oxidase (Fragment) OS=Lens culinaris E-value=2e-66; Primary amine oxidase OS=Arabidopsis thaliana E-value=2e-36; Copper methylamine oxidase OS=Arthrobacter sp. (strain P1) E-value=1e-20; Primary amine oxidase OS=Arthrobacter sp. (strain P1) E-value=1e-20; |
| Length | 657 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTFLOW; |
| Sequence | ATCGGAAACACATCGGATACGTTTGTCGGCAATCCAGCTCATCCACTTCTAACCGAAGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00340 Histidine metabolism > K11182 diamine oxidase; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K11182 diamine oxidase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K11182 diamine oxidase |
| EC | 1.4.3.22 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840058 |
| Trichome-related Gene from Literature | N/A |