Detail of EST/Unigene AJ497697 |
Acc. | AJ497697 |
Internal Acc. | AJ497697 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Uridine 5'-monophosphate synthase (Fragment) OS=Nicotiana tabacum E-value=1e-60; Uridine 5'-monophosphate synthase OS=Arabidopsis thaliana E-value=2e-60; Uridine 5'-monophosphate synthase OS=Homo sapiens E-value=3e-40; Uridine 5'-monophosphate synthase OS=Pongo abelii E-value=6e-40; Uridine 5'-monophosphate synthase OS=Bos taurus E-value=5e-39; |
Length | 637 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTFLOW; |
Sequence | TACACAGTAACATGCAATATGCAGGAGGGATCTTTCACATATTGGATTGGGCTCACATAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00762 orotate phosphoribosyltransferase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K00762 orotate phosphoribosyltransferase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01591 orotidine-5'-phosphate decarboxylase |
EC | 2.4.2.10 4.1.1.23 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824612 |
Trichome-related Gene from Literature | N/A |