Detail of EST/Unigene AJ497751 |
Acc. | AJ497751 |
Internal Acc. | AJ497751 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Methionine aminopeptidase 1D, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=3e-74; Methionine aminopeptidase 1B, chloroplastic OS=Arabidopsis thaliana E-value=4e-55; Methionine aminopeptidase 1C, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=7e-46; Methionine aminopeptidase 1D, mitochondrial OS=Danio rerio E-value=7e-39; Methionine aminopeptidase 1A OS=Arabidopsis thaliana E-value=1e-38; |
Length | 752 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTFLOW; |
Sequence | TCCGTCTCTCTGGTATGGTGGTTTCCAAAGAGTGTCTGCACATCTGTGATGATGCATTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.4.11.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829858 |
Trichome-related Gene from Literature | N/A |