| Detail of EST/Unigene AJ497846 |
| Acc. | AJ497846 |
| Internal Acc. | AJ497846 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glycine cleavage system H protein, mitochondrial (Fragment) OS=Flaveria pubescens E-value=2e-23; Glycine cleavage system H protein, mitochondrial OS=Flaveria pringlei E-value=2e-23; Glycine cleavage system H protein, mitochondrial OS=Flaveria anomala E-value=2e-23; Glycine cleavage system H protein, mitochondrial OS=Flaveria trinervia E-value=4e-23; Glycine cleavage system H protein, mitochondrial OS=Pisum sativum E-value=9e-23; |
| Length | 237 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTFLOW; |
| Sequence | AAGATCATTTGGGTGATGTTGTGTATTGAATGCCAGAAGTGGGAACGGCAGTGACACAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818078 |
| Trichome-related Gene from Literature | N/A |