| Detail of EST/Unigene AJ497876 |
| Acc. | AJ497876 |
| Internal Acc. | AJ497876 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=1e-37; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=1e-32; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=2e-22; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=1e-19; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=6e-19; |
| Length | 583 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTFLOW; |
| Sequence | AGACATGACCGCAGATGCAAATGCTACTAGTCCAACTTCAAATGGAACAAAATGGTGCAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835760 |
| Trichome-related Gene from Literature | N/A |