Detail of EST/Unigene AJ497884 |
Acc. | AJ497884 |
Internal Acc. | AJ497884 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ketol-acid reductoisomerase, chloroplastic OS=Pisum sativum E-value=5e-36; Ketol-acid reductoisomerase, chloroplastic OS=Arabidopsis thaliana E-value=1e-35; Ketol-acid reductoisomerase, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-35; Ketol-acid reductoisomerase, chloroplastic OS=Spinacia oleracea E-value=7e-34; |
Length | 347 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTFLOW; |
Sequence | CGCGGGATTGTTTCTTTCATGGTTGACAACTGCTCACCACAGCAAGGTTAGGTTCAAGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825030 |
Trichome-related Gene from Literature | N/A |