Detail of EST/Unigene AJ501453 |
Acc. | AJ501453 |
Internal Acc. | AJ501453 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase gamma chain, chloroplastic OS=Pisum sativum E-value=1e-30; ATP synthase gamma chain, chloroplastic OS=Nicotiana tabacum E-value=9e-25; ATP synthase gamma chain 1, chloroplastic OS=Arabidopsis thaliana E-value=6e-18; ATP synthase subunit gamma, chloroplastic OS=Zea mays E-value=2e-12; ATP synthase gamma chain 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-12; |
Length | 489 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTAMP; |
Sequence | GATCTCAAAACCTCTCTACTTCCTTTCATTCCCTCCACTCATTCCTTTCATGCCAATAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825797 |
Trichome-related Gene from Literature | N/A |