Detail of EST/Unigene AJ848115 |
Acc. | AJ848115 |
Internal Acc. | AJ848115 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Dihydrodipicolinate synthase, chloroplastic OS=Glycine max E-value=0; Dihydrodipicolinate synthase, chloroplastic OS=Nicotiana tabacum E-value=0; Dihydrodipicolinate synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=0; Dihydrodipicolinate synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=7e-98; Dihydrodipicolinate synthase 1, chloroplastic OS=Triticum aestivum E-value=2e-92; |
Length | 692 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtSN4; |
Sequence | CCGTGTTCAAACCAATGGGATTTGGCATGTGGAAAAGCCAGTCAATCAAAGGCAAGAGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819152 |
Trichome-related Gene from Literature | N/A |