Detail of EST/Unigene AJ848765 |
Acc. | AJ848765 |
Internal Acc. | AJ848765 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferritin-3, chloroplastic OS=Vigna unguiculata E-value=9e-13; Ferritin-2, chloroplastic OS=Glycine max E-value=6e-12; Ferritin, chloroplastic OS=Malus xiaojinensis E-value=6e-11; Ferritin-1, chloroplastic OS=Glycine max E-value=6e-11; Ferritin-1, chloroplastic OS=Pisum sativum E-value=1e-08; |
Length | 352 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtSN4; |
Sequence | GAAAATTCTGACGAGCCAAAGAAACATTATGAGCAATAGGAACAGCAAGAACATCTTTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831720 |
Trichome-related Gene from Literature | N/A |