Detail of EST/Unigene AJ969046 |
Acc. | AJ969046 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,4-xylosyltransferase IRX9H OS=Arabidopsis thaliana E-value=0; Probable glucuronosyltransferase Os10g0205300 OS=Oryza sativa subsp. japonica E-value=6e-78; Probable glucuronosyltransferase Os01g0675500 OS=Oryza sativa subsp. japonica E-value=2e-70; Probable glucuronosyltransferase Os05g0559600 OS=Oryza sativa subsp. japonica E-value=4e-65; Probable glucuronosyltransferase Os04g0103100 OS=Oryza sativa subsp. japonica E-value=2e-61; |
Length | 1696 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | AAATAGTTCTGTAATTTGTTCATTACAGGTTACCGGAGTTTCAACCTCGATCCGAACCGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase; |
EC | 2.4.1.135 2.4.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839652 |
Trichome-related Gene from Literature | N/A |