Detail of EST/Unigene AL373897 |
Acc. | AL373897 |
Internal Acc. | MtBB03E02R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=2e-21; Thioredoxin M4, chloroplastic OS=Arabidopsis thaliana E-value=3e-19; Thioredoxin M-type, chloroplastic OS=Brassica napus E-value=2e-18; Thioredoxin M-type, chloroplastic OS=Spinacia oleracea E-value=3e-18; Thioredoxin M-type, chloroplastic OS=Zea mays E-value=4e-18; |
Length | 511 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | ACTCTTTCGTCATCCATGGCCACCGTACAACTCGAATCCTTACCGAGTTACCTCCTCAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 5.3.4.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820775 |
Trichome-related Gene from Literature | N/A |