| Detail of EST/Unigene AL373897 |
| Acc. | AL373897 |
| Internal Acc. | MtBB03E02R1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=2e-21; Thioredoxin M4, chloroplastic OS=Arabidopsis thaliana E-value=3e-19; Thioredoxin M-type, chloroplastic OS=Brassica napus E-value=2e-18; Thioredoxin M-type, chloroplastic OS=Spinacia oleracea E-value=3e-18; Thioredoxin M-type, chloroplastic OS=Zea mays E-value=4e-18; |
| Length | 511 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD; |
| Sequence | ACTCTTTCGTCATCCATGGCCACCGTACAACTCGAATCCTTACCGAGTTACCTCCTCAGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 5.3.4.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820775 |
| Trichome-related Gene from Literature | N/A |