| Detail of EST/Unigene AL374111 |
| Acc. | AL374111 |
| Internal Acc. | MtBB04G02F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable monodehydroascorbate reductase, cytoplasmic isoform 2 OS=Arabidopsis thaliana E-value=9e-31; Probable monodehydroascorbate reductase, cytoplasmic isoform 3 OS=Arabidopsis thaliana E-value=4e-17; Monodehydroascorbate reductase OS=Solanum lycopersicum E-value=3e-16; Monodehydroascorbate reductase, seedling isozyme OS=Cucumis sativus E-value=5e-16; Probable monodehydroascorbate reductase, cytoplasmic isoform 4 OS=Arabidopsis thaliana E-value=3e-14; |
| Length | 466 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD; |
| Sequence | AACAACAACCGGGGAAACCATAAGTTACAAAGTTCTCATTGTTGCCACTGGTGCTCGGGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822402 |
| Trichome-related Gene from Literature | N/A |