Detail of EST/Unigene AL374112 |
Acc. | AL374112 |
Internal Acc. | MtBB04G02R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable monodehydroascorbate reductase, cytoplasmic isoform 2 OS=Arabidopsis thaliana E-value=5e-72; Probable monodehydroascorbate reductase, cytoplasmic isoform 3 OS=Arabidopsis thaliana E-value=2e-45; Monodehydroascorbate reductase, seedling isozyme OS=Cucumis sativus E-value=3e-45; Monodehydroascorbate reductase OS=Solanum lycopersicum E-value=6e-45; Probable monodehydroascorbate reductase, cytoplasmic isoform 4 OS=Arabidopsis thaliana E-value=1e-43; |
Length | 543 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | TTGAAGAATTTGGGGTGAATGGATCAGATGCAGAAAATGTATGTTACTTACGGGATATAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.-.-.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822402 |
Trichome-related Gene from Literature | N/A |