| Detail of EST/Unigene AL375037 |
| Acc. | AL375037 |
| Internal Acc. | MtBB10H07F2 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | (3S,6E)-nerolidol synthase 1, chloroplastic OS=Fragaria vesca E-value=2e-19; (3S,6E)-nerolidol synthase 2, chloroplastic/mitochondrial OS=Fragaria ananassa E-value=7e-19; Tricyclene synthase 1e20, chloroplastic OS=Antirrhinum majus E-value=1e-18; Tricyclene synthase Oc15, chloroplastic OS=Antirrhinum majus E-value=1e-18; Tricyclene synthase 0e23, chloroplastic OS=Antirrhinum majus E-value=3e-18; |
| Length | 495 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD; |
| Sequence | ACGAATCAAGTCTGTTTTATTATCAAAGCATTAATTTCTAGAATGGATGTTACATATGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827376 |
| Trichome-related Gene from Literature | N/A |