| Detail of EST/Unigene AL375452 |
| Acc. | AL375452 |
| Internal Acc. | MtBB14G07F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chaperonin CPN60-2, mitochondrial OS=Zea mays E-value=3e-17; Chaperonin CPN60-2, mitochondrial OS=Cucurbita maxima E-value=3e-17; Chaperonin CPN60-1, mitochondrial OS=Cucurbita maxima E-value=2e-16; Chaperonin CPN60-1, mitochondrial OS=Zea mays E-value=6e-16; Chaperonin CPN60, mitochondrial OS=Arabidopsis thaliana E-value=7e-15; |
| Length | 360 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD; |
| Sequence | CTCAATATTTGGAATGAATTGGATTGAAAATGTTCCAAATGTTTCAACTACATCATAGCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821983 |
| Trichome-related Gene from Literature | N/A |