Detail of EST/Unigene AL375459 |
Acc. | AL375459 |
Internal Acc. | MtBB14G10R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S17, chloroplastic (Fragment) OS=Pisum sativum E-value=5e-32; 30S ribosomal protein S17, chloroplastic OS=Arabidopsis thaliana E-value=5e-25; 30S ribosomal protein S17, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-20; 30S ribosomal protein S17, chloroplastic OS=Zea mays E-value=1e-19; 30S ribosomal protein S17 OS=Rhodospirillum centenum (strain ATCC 51521 / SW) E-value=2e-08; |
Length | 530 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | CCTCACCCGTCTCTCAAAGCCCACATCCACACTCTCTCTATCCCGACCCCAATCCCTTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844324 |
Trichome-related Gene from Literature | 844324 |