| Detail of EST/Unigene AL375538 |
| Acc. | AL375538 |
| Internal Acc. | MtBB15D04F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase F9 OS=Arabidopsis thaliana E-value=4e-44; Glutathione S-transferase F10 OS=Arabidopsis thaliana E-value=6e-43; Glutathione S-transferase F11 OS=Arabidopsis thaliana E-value=4e-34; Glutathione S-transferase F12 OS=Arabidopsis thaliana E-value=4e-31; Glutathione S-transferase F13 OS=Arabidopsis thaliana E-value=6e-27; |
| Length | 431 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD; |
| Sequence | AAGATACACTCTTGAATCTTGAATTTGAGCAGAAAACATGGTTGTGAAAGTGTATGGACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817636 |
| Trichome-related Gene from Literature | N/A |