Detail of EST/Unigene AL375634 |
Acc. | AL375634 |
Internal Acc. | MtBB16A02F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, cell wall isozyme OS=Pisum sativum E-value=1e-83; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=3e-60; Beta-fructofuranosidase, insoluble isoenzyme 1 OS=Daucus carota E-value=1e-56; Beta-fructofuranosidase, insoluble isoenzyme 2 OS=Daucus carota E-value=8e-55; Fructan 6-exohydrolase OS=Beta vulgaris E-value=1e-54; |
Length | 494 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | GGGAATTGCAATTATGTACAAAAGTAAAAATTTTGTTGATTGGTTTGAAGCCAAACATCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820591 |
Trichome-related Gene from Literature | N/A |