| Detail of EST/Unigene AL375958 |
| Acc. | AL375958 |
| Internal Acc. | MtBB20C10F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Betaine aldehyde dehydrogenase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-24; Betaine aldehyde dehydrogenase, chloroplastic OS=Amaranthus hypochondriacus E-value=2e-23; Betaine aldehyde dehydrogenase, chloroplastic OS=Beta vulgaris E-value=9e-23; Betaine aldehyde dehydrogenase, chloroplastic OS=Atriplex hortensis E-value=5e-20; Betaine aldehyde dehydrogenase 2, mitochondrial OS=Arabidopsis thaliana E-value=5e-20; |
| Length | 339 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD; |
| Sequence | GATCGATCCATTCCATACAAATCAAGAATAGATTAAAGAGAGAGAGAGAGAGAGAGAGTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843831 |
| Trichome-related Gene from Literature | N/A |