Detail of EST/Unigene AL375958 |
Acc. | AL375958 |
Internal Acc. | MtBB20C10F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Betaine aldehyde dehydrogenase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-24; Betaine aldehyde dehydrogenase, chloroplastic OS=Amaranthus hypochondriacus E-value=2e-23; Betaine aldehyde dehydrogenase, chloroplastic OS=Beta vulgaris E-value=9e-23; Betaine aldehyde dehydrogenase, chloroplastic OS=Atriplex hortensis E-value=5e-20; Betaine aldehyde dehydrogenase 2, mitochondrial OS=Arabidopsis thaliana E-value=5e-20; |
Length | 339 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | GATCGATCCATTCCATACAAATCAAGAATAGATTAAAGAGAGAGAGAGAGAGAGAGAGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843831 |
Trichome-related Gene from Literature | N/A |